The ligation product was transformed into D. radiodurans R1, and mutant colonies were selected on TGY plates containing 8 μg/mL streptomycin. Null mutants were confirmed by PCR and sequencing, and the resulting mutant was designated mntE – . Table 2 Primers used in this study Primer Sequence (5′ → 3′) Construction of the mntE – mutant ME1 GCACGCGCTTTTCCTATGAC ME2 ATATGGATCCACCACCGCACTGAGGTATTC ME3 ATATAAGCTTCCGGCGCCAACGTCACCATT ME4 CGCCGACCAGGACACGATAG Complementation of the mntE – mutant ME5 ATATCATATGCCGGTTTTCGTGGCG ME6 ATATGGATCCCAGGTCTATCAACTGTGGGA A complementary plasmid was constructed and transformed into the mntE – mutant as described previously [25]. Briefly,

the dr1236 gene with the buy LY2603618 NdeI and BamHI sites was amplified with

primers ME5/ME6. The PCR product was ligated to the pMD18-T simple vector (Takara, JP), and the product was designated pMDmntE. After digestion with MK-0457 manufacturer NdeI and BamHI, the target gene MntE was ligated to NdeI- and BamHI-predigested pRADK [23]. The complementation plasmid was confirmed by PCR and DNA sequence analyses and transformed into the mntE – strain. Cation sensitivity assay Cation sensitivity assays were carried out as described previously [18]. Solutions (1 M) of manganese chloride, manganese sulfate, calcium chloride, magnesium chloride, zinc chloride, cobalt (II) chloride, copper chloride, ferric chloride, and ferrous sulfate (Sigma) were prepared in milli-Q water and filter-sterilized by passing

through 0.22-μm filters. Cells grown to the early stationary phase in TGY broth were plated on TGY plates and overlaid with 5-mm sterile filter discs containing 10 μL of various cation solutions. The plates were incubated for three days, and the inhibition zone of each disc was measured. To measure the growth of mntE – and R1, 1 × 105 cfu mL-1 were grown DCLK1 in TGY supplemented with increasing concentrations of MnCl2. The OD600 value was measured 12 h post incubation (mean ± SD of three experiments). Inductively coupled plasma-mass spectrometry (ICP-MS) assay For the ICP-MS assays [26], the cells were cultured in TGY broth that had been pretreated with Chelex (Sigma) to remove any cations and supplemented with 50 μM manganese, 10 μM ferric chloride, 100 mM magnesium, or 100 mM calcium chloride. Cells (OD600 = 0.6-0.8) were harvested by centrifugation, washed three times with phosphate-buffered saline (PBS) containing 10 mM EDTA, and rinsed three times with PBS without EDTA. Cells (1/10 of the total volume) were withdrawn to measure the dry weight, and the remaining cells were treated with nitric acid and used for the ICP-MS assay. Survival curves of the mntE- mutant and R1 R1 and mntE – cells were cultured in TGY broth with or without 50 μM manganese to OD600 = 1.0, centrifuged, and then resuspended in phosphate buffer. For the γ-irradiation treatment, the suspension was irradiated with different doses of 60Co γ-radiation for 1 h on ice.