Sequencing was performed with the Big Dye™ Terminator Cycle Sequencing Ready Kit, version 3.0 (ABI Prism™, Perkin Elmer) and an ABI 3700 Applied Biosystems Model automated DNA sequencer. Nucleotide sequences of NWS were analyzed by BLASTN ( Altschul et al., 1997) to search for similarities, and sequence alignments were carried out using ClustalX ( Thompson et al., 1997). The prediction of the signal peptide was performed using Signal P v.3.0 ( Bendtsen et al., 2004). To genotype the E3 gene, PCR-RFLP reactions were performed according to Carvalho et al. (2006). Based on the AChE sequence obtained in this work, new primers were designed, Achef3

(5′ AATCCCCAATCGGTTATG 3′) and Acher3 (5′ TTGCAATCATTTATCAAAGC 3′), to analyze the occurrence SCH 900776 solubility dmso of the three point mutations associated with OP resistance GW 572016 (I298V, G401A, F466Y), avoiding the amplification of one large intron (Fig. 1). Primers combination used for this analysis was Achef2/Acher3 and Achef3/Acher2. PCR conditions were similar to those used for AChE cDNA amplification, with optimization of MgCl2 concentration (2.5 mM), annealing temperature (53 °C), extension time (50 s at 72 °C) and use

of 25–100 ng of genomic DNA. PCR products were purified using the QIAquick® PCR purification Kit (Qiagen) and directly sequenced. Nucleotide sequences presenting a double peak in the chromatogram, indicating possible nucleotide heterogeneity, were cloned into the pGEM-T plasmid vector (Promega) and six clones of each were sequenced. Characterization of the AChE cDNA sequence was used to investigate putative mutations involved in OP resistance. Although a few nucleotide substitutions have been observed among sequenced clones, mainly in the N and C terminal regions, a consensus sequence was assembled and the NWS populations surveyed for three point mutations because previously characterized in conferring OP resistance in D. melanogaster and L. cuprina. Since a NWS

susceptible reference strain is not available in Brazil, it is not possible to examine our data to infer the influence of other nucleotide substitutions on a resistant phenotype. The ORF of NWS AChE is comprised of 2250 nucleotides (GenBank accession number FJ830868), showing significant nucleotide similarity (88%) with L. cuprina AChE. The deduced amino acid sequence of NWS AChE was compared to the AChE amino acid sequences from other fly species, showing a high identity with L. cuprina (93%), Haematobia irritans (90%), M. domestica (90%) and D. melanogaster (88%). The W222 residue (position according to sequence of C. hominivorax), the main component of the choline binding site, is conserved among the species. The predicted members of the catalytic triad correspond to residues in the positions Serine374, Glutamate503 and Histidine616 (S200, E327, H440 in Torpedo californica, Schumacher et al., 1986) ( Fig. 2).