Currently, in the aftermath of the nuclear power reactor accident in Fukushima, the assessment of environmental and social risks associated with technological and natural uncertainties is thought

to be particularly important. Yet this type of assessment lies outside the scope of this study. Instead, we focus on the costs and mitigation potentials of low-carbon technologies.   3 Bioenergy supply is assumed to cause no major land use change or additional CO2 emission in any of the scenarios in this study. See “Key assumptions on the availability of resources and technologies” for more detail.   4 This is a rough approximation of the relationship between bioenergy supply and CO2 emission from land use change. More detailed analysis Tariquidar on bioenergy utilization and CO2 emission requires an integrated modeling approach on energy and land use. Yet this type of analysis selleck inhibitor remains to be done.   5 The nuclear power plant accident in Fukushima may increase scepticism about the safety of nuclear power plants and persuade some countries to scale down their nuclear policies. Some countries, in fact, have already announced plans to phase out their nuclear plants. Overall, however, the impact of the Fukushima nuclear accident over long-term nuclear policies around the world remains to be seen. Therefore, this

impact is not considered in this study. Molecular motor   6 AIM/Enduse[Global] includes integrated biomass gasification combined cycle (biomass IGCC) with CCS as an option for power generation. Biomass IGCC is a promising biomass power generation technology considered both highly efficient and economically feasible, as it is technically similar to the efficient coal IGCC process and can profit from the experiences gained with coal IGCC plants (Rhodes 2007). When biomass IGCC and CCS are integrated in a combined system, nearly all CO2 can be captured (Luckow et al. 2010). Yet biomass

IGCC is still in the demonstration phases: only a few demonstration plants have been built so far.”
“Transitions to cleaner, renewable energy are at the heart of policies in many countries. The focus on renewables has, if anything, become greater recently as uncertainty grows about the viability and acceptability of alternatives to achieve low-carbon growth, including nuclear power and carbon capture and storage (REN21 2010). The Fukushima accident has forced many governments to rethink their nuclear energy plans—Japan has just shutdown their last nuclear power plant, and Germany announced last year it will be nuclear free by 2022. But transitions away from fossil fuel-based energy systems have proven slow despite the potential of renewable energy sources and advancing technologies to utilize them.

Periphery immunocytes may secrete tumor-suppressive learn more miRNAs to block tumor growth and propagation. MiRNAs are important modulators of tumor-associated angiogenesis. The miR-17-92 cluster, which includes miR-17, miR-18a, miR-19a/b, miR-20a, and miR-92a, has been linked to tumor angiogenesis. Overexpression of the entire miR-17-92 cluster in myc-induced tumors has been found to increase angiogenesis by paracrine signaling [66]. However, overexpression of the individual members of the miR-17-92 cluster reduced endothelial cell sprouting,

while inhibitors of these miRNAs augmented angiogenesis in vitro, indicating that the miR-17-92 cluster provides a cell-intrinsic antiangiogenic activity in endothelial cells [67]. Another study by Grange et al. [68] found that microvesicles released from CD105+ renal cancer stem cells, in which 57 miRNAs were differentially

expressed, contributed to triggering the angiogenic switch and coordinating metastatic diffusion during tumor progression. While miR-27b and let-7f were described as proangiogenic miRNAs, miR-221 and miR-222 were identified as antiangiogenic miRNAs in endothelial cells [69–71]. MiRNAs may also influence angiogenesis by acting on endothelial progenitor cells (EPCs) since EPCs play an important role in neovascularization. miR-34a was reported as a tumor suppressor and regulates cell cycle, senescence, apoptosis, and metabolism [72, 73]. A recent study found that overexpression of miR-34a in EPCs impaired EPC-mediated selleck angiogenesis by inducing senescence via the inhibition of silent information regulator 1 (SIRT 1). This study provided a mechanistic insight on miRNA-mediated regulation of EPC function [74]. The question of whether in the course of EPC homing to tumor cells, second circulating miRNAs have some specific function remains unanswered. They could

conceivably act as chemokines, which direct EPCs to tumor neovessels and promote vessel growth [75]. This topic certainly warrants further investigation. Application of circulating miRNAs Their stability and predictive property make miRNAs ideal serum and plasma biomarkers in cancer patients. A variety of independent studies have successfully proved the importance of miRNAs as a tool of cancer diagnosis. Wu and colleagues found that miR-21and miR-29 were significantly upregulated in the serum of breast cancer patients and may be useful biomarkers for breast cancer detection [76, 77]. In non-small cell lung cancer (NSCLC), the expressions of miR-1254 and miR-574-5p were significantly increased with respect to controls. They were able to discriminate tumor samples from controls with 82% and 77% sensitivity and specificity, respectively, as judged by the use of a receiver operating characteristic (ROC) curve [78]. Wei et al.

X-axis: time (min); Y-axis: pH; log cfu are shown in colour (scale on the right of the graphs). Numbers in the bacterial names are the strain numbers in the FAM-database of ALP. Figure 3 Acid resistance of Bifidobacterium dentium, B. longum subsp. infantis and B. adolescentis. X-axis: time (min); Y-axis: pH; log cfu are shown in colour (scale on the right of the graphs). Numbers in the bacterial names are the strain numbers in the FAM-database of ALP. Figure 4 Acid resistance of Bifidobacterium breve and B. animalis subsp. lactis. X-axis: time (min); Y-axis:

pH; log cfu are shown in colour (scale on the right PRIMA-1MET in vivo of the graphs). Numbers in the bacterial names are the strain numbers in the FAM-database of ALP. All the other tested Bifidobacterium strains (B. longum, B. breve, B. longum subsp. infantis and B. adolescentis) showed a similar but different pattern from B. animalis subsp. lactis (Figures 2, 3 and 4). They had a short survival time below pH 2.5 and survived in higher numbers above pH 3.5. With the aim of developing a method to simulate the GI in the bioreactor, a further test was done with one strain. To observe the influence of a food matrix, concentrated B. longum subsp. infantis was resuspended in skim milk IWR-1 cell line before inoculating into acidic solutions.

As shown in the right-hand column of Figure 5, milk had a direct effect on the survival of the strain. Between pH 3.0 and 3.5 the bacteria survived for 120 min with a reduction of log 2. Below pH 3.0 the survival rate decreased to about log 5. The decrease in survival below pH 3.0 was rapid but regular over time. At pH 3.5 and above, the strain was resistant for at least 120 minutes. Figure 5 Comparison of acid resistance of Bifidobacterium longum subsp. infantis 14390 suspended in NaCl or skim milk. Left: Bifidobacteria resuspended in NaCl, right: Bifidobacteria resuspended in milk. X-axis: time (min); Y-axis: pH; log cfu

are shown in colour (scale on the right of the graphs). Numbers in the bacterial names are the strain numbers in the FAM-database of ALP. The left-hand column of Etofibrate Figure 5 shows the same strain without added skim milk. At a pH above 3.5, there was no influence on the survival of the bacteria. However, below pH 3.5 the survival decreased depending on the duration of incubation. Between pH 3.0 and 3.5 the strain had already decreased by about log 5. After 30 min incubation, there was almost a linear decrease in survival with decreasing pH from 3.0 to 2.5. Simulation in the bioreactor Most systems described in the literature consist of several reaction vessels, e.g. the SHIME [6]. Other studies used immobilized cells with three reactors [25] or a dialysis system [8]. Based on the work of Sumeri et al. [9] and the collected data of the conditions in the intestinal passage we were able to limit the simulation to one vessel.

Nanoscale Res Lett 2011,6(1):1–13. 4. Mehrali M, Tahan Latibari S, Mehrali M, Mahlia TMI, Metselaar HSC: Preparation and properties of highly conductive palmitic acid/graphene oxide composites as thermal energy storage materials. Energy 2013, 58:628–634.CrossRef 5. Pastoriza-Gallego MJ, Lugo L,

Legido JL, Piñeiro MM: Thermal conductivity and viscosity measurements of ethylene glycol-based Al 2 O 3 nanofluids. Nanoscale Res Lett 2011,6(1):1–11. 6. Zhi C, Xu Y, Bando Y, Golberg D: Highly thermo-conductive fluid with boron nitride nanofillers. ACS Nano 2011,5(8):6571–6577.CrossRef 7. Neogy RK, Raychaudhuri AK: Effect of stabilizer on dynamic thermal transport property of ZnO nanofluid. Nanoscale Res Lett selleck compound 2013,8(1):1–6.CrossRef 8. Yeganeh M, Shahtahmasebi N, Kompany A, Goharshadi EK, Youssefi A, Šiller L: Volume fraction and temperature variations of the effective thermal conductivity of nanodiamond fluids in deionized water. Int J Heat Mass Transf 2010,53(15–16):3186–3192.CrossRef 9. Wang J, Xie H, Xin Z, Li Y: Increasing the thermal conductivity of palmitic acid by the addition of carbon nanotubes. Carbon 2010,48(14):3979–3986.CrossRef 10. Lee KJ, Yoon SH, Jang J: Carbon

nanofibers: Cyclosporin A a novel nanofiller for nanofluid applications. Small 2007,3(7):1209–1213.CrossRef 11. Yu W, Xie H, Bao D: Enhanced thermal conductivities of nanofluids containing graphene oxide nanosheets. Nanotechnology 2010,21(5):055705.CrossRef 12. Baby TT, Ramaprabhu S: Investigation of thermal and Farnesyltransferase electrical conductivity of graphene based nanofluids. J Appl Phys 2010,108(12):124308.CrossRef 13. Zheng R, Gao J, Wang J, Feng SP, Ohtani H, Wang J, Chen G: Thermal percolation in stable graphite suspensions. Nano Lett 2011,12(1):188–192.CrossRef 14. Baby TT, Ramaprabhu S: Synthesis and nanofluid application of silver nanoparticles decorated graphene. J Mater Chem 2011,21(26):9702–9709.CrossRef 15. LotfizadehDehkordi B, Kazi SN, Hamdi

M, Ghadimi A, Sadeghinezhad E, Metselaar HSC: Investigation of viscosity and thermal conductivity of alumina nanofluids with addition of SDBS. Heat Mass Transf 2013,49(8):1109–1115.CrossRef 16. Hassan M, Sadri R, Ahmadi G, Dahari MB, Kazi SN, Safaei MR, Sadeghinezhad E: Numerical study of entropy generation in a flowing nanofluid used in micro-and minichannels. Entropy 2013,15(1):144–155.CrossRef 17. Buongiorno J, Venerus DC, Prabhat N, McKrell T, Townsend J, Christianson R, Tolmachev YV, Keblinski P, Hu LW, Alvarado JL, Bang IC, Bishnoi SW, Bonetti M, Botz F, Cecere A, Chang Y, Chen G, Chen H, Chung SJ, Chyu MK, Das SK, Di Paola R, Ding Y, Dubois F, Dzido G, Eapen J, Escher W, Funfschilling D, Galand Q, Gao J, et al.: A benchmark study on the thermal conductivity of nanofluids. J Appl Phys 2009,106(9):094312.CrossRef 18. Nasiri A, Shariaty-Niasar M, Rashidi AM, Khodafarin R: Effect of CNT structures on thermal conductivity and stability of nanofluid. Int J Heat Mass Transf 2012,55(5–6):1529–1535.CrossRef 19.

As described above, the BarA/SirA system is involved MK-8776 cell line in not only the flagella gene expression but also the SPI-1 gene expression. Phosphorylated SirA directly interacts with promoters of

the hilA and hilC genes that are the SPI-1-encoded transcription regulator genes [58]. HilA, a member of the OmpR/ToxR family, directly activates transcription of the inv/spa and prg/org promoters on SPI-1 [59]. In addition to the BarA/SirA system, the AraC-like regulator RitA directly controls the hilA expression leading to SPI-1 gene expression, while RitB, a helix-turn-helix DNA binding protein, negatively regulates the expression of the flhDC [60]. Reports also show that the ATP-dependent ClpXP protease negatively regulates the expression of flagella and SPI-1 gene [54, 61]. Interestingly, mutation in the SPI-2 genes also affects the expression of the SPI-1 gene [62]. And thus many reports show the relationship of flagella synthesis and SPI-1 gene expression.

Our S3I-201 solubility dmso recent studies show that the SpiC-dependent expression of FliC plays a significant role in activation of the signaling pathways leading to the induction of SOCS-3, which is involved in the inhibition of cytokine signaling, in Salmonella-infected macrophages [16]. Lyons et al. [63] also reported that infection of polarized epithelial cells by Salmonella leads to IL-8 expression by causing the SPI-2-dependent translocation of flagellin to a basolateral membrane Bay 11-7085 domain expressing

TLR5. Together with our previous results, these findings suggest the involvement of FliC in SPI-2-dependent events in the pathogenesis of Salmonella infection. Conclusion In conclusion, here we show that SpiC encoded within SPI-2 is required for flagella assembly in S. enterica serovar Typhimurium. We concluded that the mechanism is due to the involvement of SpiC in the post-transcriptional expression of FlhDC. The data indicate the possibility that SPI-2 plays a role in Salmonella virulence by making use of the flagellar system. Methods Bacterial strains, plasmids, and growth conditions The bacterial strains used in this study were derived from the wild-type S. enterica serovar Typhimurium strain 14028s. The spiC::kan derivative EG10128 was described by Uchiya et al. [7]. The deletion mutant in the flhD gene was constructed using the Red recombination system [64]. To delete the flhD or spiC gene, a kanamycin resistance gene flanked by FLP recognition target sites from plasmid pKD4 was amplified using PCR with primer regions homologous to the flhD gene (5′-TGCGGCTACGTCGCACAAAAATAAAGTTGGTTATTCTGGATGGGAGTGTAGGCTGGAGCTGCTTC-3′ and 5′-CGCGAGCTTCCTGAACAATGCTTTTTTCACTCATTATCATGCCCTCATATGAATATCCTCCTTAGT-3′) or the spiC gene (5′-TTGTGAGCGAATTTGATAGAAACTCCCATTTATGTCTGAGGAGGGGTGTAGGCTGGAGCTGCTTC-3′ and 5′-AGATTAAACGTTTATTTACTACCATTTTATACCCCACCCGAATAACATATGAATATCCTCCTTAGT-3′).

, DE, USA) and visually by standard agarose gel electrophoresis [1% agarose (w:v) in TBE 1X] [60]. Bacterial DNA to be used immediately

in PCR assays was also obtained by thermal lysis of the pellets from 1 ml of the above mentioned titrated cultures. Each pellet was carefully resuspended in sterile distilled water (100 μl/pellet), incubated at 95°C for 10 min and immediately cooled on ice. After a quick spin in a microcentrifuge, 1 μl lysate was directly used in PCR assays as template. DNA from P. savastanoi host (olive, oleander and ash) and non-host (oak) plants was extracted using Puregene® DNA Isolation Kit (Gentra System Inc.), according to procedure suggested by manufacturers

for vegetable materials. Prior to be used in PCR specific assays, DNA was always checked for its amplificability BIIB057 order selleck kinase inhibitor and the absence of PCR inhibitors, then testing only those giving positive results. Bacterial DNA was amplified using bacterial 16S rDNA universal primers [58] and plant DNA preparations were tested after being spiked with 50 ng of the bacterial DNA target of the primer pair used. ERIC-PCR experiments and design of pathovar-specific primers The Rep-PCR experiments were carried out according to Louws et al. (1994) [61], with slight modifications and using Enterobacterial Repetitive Intergenic Consensus (ERIC) primers. The primers ERIC1R and ERIC2 [48] were synthesized by PRIMM (PRIMM srl, Milan, Italy). Amplifications were performed in a programmable thermal cycler Biometra T Professional Basic (Biometra, Goettingen, Germany), in thin-walled 0.5-ml Eppendorf tubes (Sarstedt, Numbrech, Germany), in a 25 μl volume with 50 ng of DNA template per reaction. The reaction mixture and the cycling protocol were already described [62]. Negative controls were included in all PCR amplifications to test for contaminants in the reagents used. For each bacterial isolate,

amplification reactions were conducted at least twice, in three separate experiments. Aliquots (10 μl) of PCR products were analysed by electrophoresis in 2% (w:v) agarose gels with 1 × TAE buffer [60], stained with ethidium bromide. The results were visualized, recorded by a video camera and Vorinostat cell line processed by Alphaimager™ system (Alpha Innotech Corporation, San Leandro, CA, USA). The length of the DNA fragments was estimated by comparison with 1 Kb Plus DNA Ladder (Invitrogen Inc, Carlsbad, CA, USA). Amplification profiles were analysed by visual examinations and those amplicons supposed to be pathovar-specific were purified from agarose gel with PureLink® Quick Gel Extraction Kit (Invitrogen) and cloned using TOPO® TA Cloning Kit (Invitrogen) and chemically competent E. coli DH5-a cells, under the conditions recommended by the manufacturer.

M. tuberculosis was grown in 7H9-OADC-TW broth at 37°C, and lysates prepared using a bead beater. About 500 g protein was separated in 10-40% sucrose gradient. A. The ODs of the separated fractions were measured (manually) at 260 nm. B. The proteins in the fractions were then

precipitated with ethanol and separated on SDS-PAGE, transferred to nitrocellulose membranes, and probed with anti-Obg antiserum (1:500 dilution), followed by peroxidase-labeled anti-rabbit IgG (1:10,000 dilution, Sigma). The blots were developed with an ECL kit (Amersham) and autoradiographed. Lane C is a whole-cell extract from M. tuberculosis. Lanes 1-15 represent fractions from the top (10% sucrose) to the bottom (40% sucrose) of the sucrose gradient. Fraction 16 was not analyzed in immunoblot. M. FK228 manufacturer tuberculosis Obg interacts with UsfX Scott et al [41] were the first to observe I-BET151 that B. subtilis Obg interacts with upstream regulators of the stress sigma factor SigB. In this respect,

this bacterium’s Obg resembles B. subtilis RsbT and RsbW, both of which also interact with SigB in this species [41]. More recently, the Obg proteins of E. coli [20] and V. harveyi [21] have been shown to interact with SpoT, a stringent response regulator. Since SigB, RsbW and SpoT-related genes are present in M. tuberculosis, we asked whether M. tuberculosis Obg interacts with any or all of these proteins, in the yeast two-hybrid system. The M. tuberculosis genes coding for Obg (Rv2240c), UsfX (homologue of RsbW, Rv3287c), SigF (homologue of SigB of B. subtilis, Rv3286c) and RelA (a stringent response regulator related to SpoT, Rv2853c) were cloned in yeast vectors, and transformed into the yeast strain AH109. Table 1 shows that M. tuberculosis Obg strongly interacts with UsfX, but not with the SpoT-related RelA protein. The strength of this interaction is comparable to the interaction of M. tuberculosis UsfX with its cognate

sigma factor SigF. In the same experiment, we looked for interaction of M. tuberculosis Obg with various other putative anti-anti sigma factors that we have described earlier for this bacterium [42], including RsbU (Rv1364c), RsfA (Rv1365c), RsfB (Rv3687c), Rv0516c, Rv1904 and Rv2638. However, we observed no significant interaction of Obg with any of the Cediranib (AZD2171) above anti-anti sigma factors (data not shown), indicating that the interaction of M. tuberculosis Obg is limited to UsfX. In light of the known stress response role of UsfX [43], its specific interaction with Obg suggests that Obg plays a role in the M. tuberculosis stress response. Table 1 Interaction of Obg with stress related proteins in the yeast two-hybrid system.   *Plasmids SD Minimal Medium Mel-l (α-gal) in SD plates Mel-1 (α-gal) in SD broth**     -Leu/ -Trp -His/ -Leu/-Trp -Ade/-His/ -Leu/-Trp     1. pGADT7-T + + + +++ 3.512 ± 0.709   pGBKT7-53           2. pGADT7-T + – - – -   pGBKT7-Lam           3. pGA3287c + + + ++ 2.367 ± 0.354   pGB3286c           4. pGA3287c + + + ++ 2.

2007), predominating underestimation (Burdorf and Laan 1991), and deviations in both directions in one sample (Jensen et al. 2000). Thus, the assessment behaviour may depend on the wording of the questionnaire, the study sample, or the exposure level (Barrero et al. 2009). As this study indicates, exposure level seems to have an enormous impact on the validity of self-reported knee exposure. In both surveys, Selleckchem AZD8931 differences between reported and recorded durations of knee postures were small at a low exposure level but increased with increasing

exposure. Participants were able both to report the absence of knee postures exactly and to assess short time exposure, especially by comparing absolute values (see Bland–Altman plots) rather than relative ones. On the other hand, high-exposed subjects were misjudging their amount of knee loading by far. Confirming this effect, a study on the duration of computer use of 87 computer workers reports comparable assessment behaviour for low- and high-exposed subjects (Heinrich et al. 2004). But in contrast, another study on that topic gives an opposite GW3965 solubility dmso result: agreement between self-reported and observed duration of computer

use of 572 office workers improved with increasing exposure (IJmker et al. 2008). This effect might be explained by the use of categorical data (seven response categories for hours of computer use per day), while we used continuous data for assessment in our study. With respect to occupational knee load, only one of the cited studies took assessment behaviour of low- and high-exposed subjects into consideration (Klußmann et al. 2010). In a sub-analysis of this study, high-exposed workers showed a better ability to assess their exposure than low-exposed. However, study sample was rather small (n = 25) and deviations between mafosfamide both methods were only reported as relative differences instead of absolute numbers;

thus, the effect may be overestimated. Impact of knee disorders on the validity of self-reports The present study gave no hint of a differential misclassification of exposure due to self-reported knee complaints. Participants both with and without such complaints showed comparable assessment behaviour. This result seems to be contrary to studies reporting differential misclassifications caused by several forms of musculoskeletal complaints and risk factors such as low back pain and manual material handling (Wiktorin et al. 1993), neck-shoulder complaints and awkward postures of head, back and arms (Hansson et al. 2001), or upper limb complaints, and physical activity (Balogh et al. 2004). In terms of occupational kneeling or squatting, only a few studies considered the impact of musculoskeletal disorders on the assessment behaviour. Moreover, if complaints were taken into account, it was not about knee complaints. Burdorf and Laan (1991) found no impact of low back pain or shoulder pain on self-reported kneeling or squatting of mechanical repairmen.

5 Conclusions

Strawberry-flavored sugar-free AMC/DCBA lozenges were liked by, and acceptable to, the majority of the children in this NU7026 datasheet study; this flavor preference is in line with previous children’s medicine studies in Europe. Orange-flavored colour-free AMC/DCBA lozenges with vitamin C were liked by, and acceptable to, approximately half of the children, and older children (10–12 years) found them more acceptable than 6- to 10-year-olds did. Overall, both strawberry and orange would be suitable flavors for lozenges intended for children when they suffer from sore throat. Acknowledgements This study was funded by Reckitt Benckiser Healthcare Ltd, UK. Editorial assistance for the development of this article was provided by Elements Communications Ltd, UK, supported by Reckitt Benckiser Healthcare Ltd, UK. Author JQ-EZ-05 clinical trial Contributions Alex Thompson contributed to the acquisition, analysis, and interpretation of data. Sandie Reader contributed to the writing of the clinical study report. Emma Field contributed to the writing of the study protocol and clinical study report. Adrian Shephard contributed to the concept development of the study and the study protocol and reviewing of the clinical study report. All authors were involved in drafting, reviewing, and final approval of the manuscript. Conflict

of Interest Alex Thompson is employed by Aspect Clinical, who were paid by Reckitt Benckiser to conduct the study. Dr Thompson received no direct payments

to conduct the study. Sandie Reader has received payments from Reckitt Benckiser for freelance clinical project management and medical writing in the past 5 years, and was paid to write the clinical study report on which this manuscript is based. Emma Field and Adrian Shephard are employees of Reckitt Benckiser. Open AccessThis article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. The exclusive right to any commercial use of the article is with Springer. References 1. Gerber MA. Diagnosis and treatment of pharyngitis in children. Pediatr Clin North Am. 2005;52(3):729–47.PubMedCrossRef oxyclozanide 2. Schappert SM, Rechtsteiner EA. Ambulatory medical care utilization estimates for 2006. Natl Health Stat Rep. 2008;8:1–29. 3. Regoli M, Chiappini E, Bonsignori F, et al. Update on the management of acute pharyngitis in children. Ital J Pediatr. 2011;31(37):10.CrossRef 4. Shaikh N, Leonard E, Martin JM. Prevalence of streptococcal pharyngitis and streptococcal carriage in children: a meta-analysis. Pediatrics. 2010;126(3):e557–64.PubMedCrossRef 5. Wade AG, Morris C, Shephard A, et al. A multicentre, randomised, double-blind, single-dose study assessing the efficacy of AMC/DCBA Warm lozenge or AMC/DCBA Cool lozenge in the relief of acute sore throat.

The ligation product was transformed into D. radiodurans R1, and mutant colonies were selected on TGY plates containing 8 μg/mL streptomycin. Null mutants were confirmed by PCR and sequencing, and the resulting mutant was designated mntE – . Table 2 Primers used in this study Primer Sequence (5′ → 3′) Construction of the mntE – mutant ME1 GCACGCGCTTTTCCTATGAC ME2 ATATGGATCCACCACCGCACTGAGGTATTC ME3 ATATAAGCTTCCGGCGCCAACGTCACCATT ME4 CGCCGACCAGGACACGATAG Complementation of the mntE – mutant ME5 ATATCATATGCCGGTTTTCGTGGCG ME6 ATATGGATCCCAGGTCTATCAACTGTGGGA A complementary plasmid was constructed and transformed into the mntE – mutant as described previously [25]. Briefly,

the dr1236 gene with the buy LY2603618 NdeI and BamHI sites was amplified with

primers ME5/ME6. The PCR product was ligated to the pMD18-T simple vector (Takara, JP), and the product was designated pMDmntE. After digestion with MK-0457 manufacturer NdeI and BamHI, the target gene MntE was ligated to NdeI- and BamHI-predigested pRADK [23]. The complementation plasmid was confirmed by PCR and DNA sequence analyses and transformed into the mntE – strain. Cation sensitivity assay Cation sensitivity assays were carried out as described previously [18]. Solutions (1 M) of manganese chloride, manganese sulfate, calcium chloride, magnesium chloride, zinc chloride, cobalt (II) chloride, copper chloride, ferric chloride, and ferrous sulfate (Sigma) were prepared in milli-Q water and filter-sterilized by passing

through 0.22-μm filters. Cells grown to the early stationary phase in TGY broth were plated on TGY plates and overlaid with 5-mm sterile filter discs containing 10 μL of various cation solutions. The plates were incubated for three days, and the inhibition zone of each disc was measured. To measure the growth of mntE – and R1, 1 × 105 cfu mL-1 were grown DCLK1 in TGY supplemented with increasing concentrations of MnCl2. The OD600 value was measured 12 h post incubation (mean ± SD of three experiments). Inductively coupled plasma-mass spectrometry (ICP-MS) assay For the ICP-MS assays [26], the cells were cultured in TGY broth that had been pretreated with Chelex (Sigma) to remove any cations and supplemented with 50 μM manganese, 10 μM ferric chloride, 100 mM magnesium, or 100 mM calcium chloride. Cells (OD600 = 0.6-0.8) were harvested by centrifugation, washed three times with phosphate-buffered saline (PBS) containing 10 mM EDTA, and rinsed three times with PBS without EDTA. Cells (1/10 of the total volume) were withdrawn to measure the dry weight, and the remaining cells were treated with nitric acid and used for the ICP-MS assay. Survival curves of the mntE- mutant and R1 R1 and mntE – cells were cultured in TGY broth with or without 50 μM manganese to OD600 = 1.0, centrifuged, and then resuspended in phosphate buffer. For the γ-irradiation treatment, the suspension was irradiated with different doses of 60Co γ-radiation for 1 h on ice.