The majority of the data presented here were recorded while passively fixating animals experienced a range of different heading

directions that spanned the horizontal and/or vertical plane (Gu et al., 2006 and Takahashi et al., 2007). Specifically, headings relative to straight ahead were 0, ±22.5, ±45, ±90, ±135°, ±180°. Different heading directions and stimulus types (visual or vestibular) were interleaved randomly within a single block of trials. Each distinct stimulus was typically repeated five times (minimum of three repetitions for inclusion). In each trial, a fixation point first appeared at the center of the screen. After fixation was established for 100–200 ms, the motion stimulus began and lasted for 2 s. In the vestibular condition, the motion platform always began its movement from a common central position. Metformin mw The animal was rewarded if they maintained visual fixation throughout Selleckchem Sunitinib the duration of the stimulus. At the end of the trial (or when fixation was broken), the fixation point disappeared and the motion platform moved

back to the original central position during a 2 s intertrial interval. In the visual condition, the random-dot field appeared on the display after fixation was established, and again moved for 2 s. The dots then disappeared and the animal was rewarded for maintaining fixation, followed again by a 2 s intertribal interval. Three animals were trained many only to perform the passive fixation task, whereas five animals had been extensively trained to perform a heading discrimination task (Fetsch et al., 2009, Gu et al., 2007 and Gu et al., 2008a), in which they were asked to report whether their perceived heading was leftward or rightward relative to straight ahead by making a saccade to one of two choice targets. For a subpopulation

of neurons in these trained animals, responses were obtained while the animals performed both the fixation task and the heading discrimination task. We conducted extracellular recordings of action potentials from single neurons in area MSTd. For most recordings, 2 to 4 tungsten electrodes (Frederick Haer, Bowdoinham, ME; tip diameter 3 μm, impedance 1–2 MΩ at 1 kHz) were used to record multiple single neurons simultaneously. In some cases (57 pairs), two to four electrodes were placed inside multiple guide tubes separated by 0.8–25 mm (different hemispheres). In other cases (55 pairs), multiple electrodes were placed inside a single guide tube. The distance between two simultaneously recorded neurons was estimated from both the horizontal and vertical (depth) coordinates (shank diameter = 75 μm). Data from another 67 cell pairs were obtained from previous recordings with a single electrode (Fetsch et al., 2007, Gu et al., 2006, Gu et al., 2007 and Takahashi et al.

Sequencing was performed with the Big Dye™ Terminator Cycle Sequencing Ready Kit, version 3.0 (ABI Prism™, Perkin Elmer) and an ABI 3700 Applied Biosystems Model automated DNA sequencer. Nucleotide sequences of NWS were analyzed by BLASTN ( Altschul et al., 1997) to search for similarities, and sequence alignments were carried out using ClustalX ( Thompson et al., 1997). The prediction of the signal peptide was performed using Signal P v.3.0 ( Bendtsen et al., 2004). To genotype the E3 gene, PCR-RFLP reactions were performed according to Carvalho et al. (2006). Based on the AChE sequence obtained in this work, new primers were designed, Achef3

(5′ AATCCCCAATCGGTTATG 3′) and Acher3 (5′ TTGCAATCATTTATCAAAGC 3′), to analyze the occurrence SCH 900776 solubility dmso of the three point mutations associated with OP resistance GW 572016 (I298V, G401A, F466Y), avoiding the amplification of one large intron (Fig. 1). Primers combination used for this analysis was Achef2/Acher3 and Achef3/Acher2. PCR conditions were similar to those used for AChE cDNA amplification, with optimization of MgCl2 concentration (2.5 mM), annealing temperature (53 °C), extension time (50 s at 72 °C) and use

of 25–100 ng of genomic DNA. PCR products were purified using the QIAquick® PCR purification Kit (Qiagen) and directly sequenced. Nucleotide sequences presenting a double peak in the chromatogram, indicating possible nucleotide heterogeneity, were cloned into the pGEM-T plasmid vector (Promega) and six clones of each were sequenced. Characterization of the AChE cDNA sequence was used to investigate putative mutations involved in OP resistance. Although a few nucleotide substitutions have been observed among sequenced clones, mainly in the N and C terminal regions, a consensus sequence was assembled and the NWS populations surveyed for three point mutations because previously characterized in conferring OP resistance in D. melanogaster and L. cuprina. Since a NWS

susceptible reference strain is not available in Brazil, it is not possible to examine our data to infer the influence of other nucleotide substitutions on a resistant phenotype. The ORF of NWS AChE is comprised of 2250 nucleotides (GenBank accession number FJ830868), showing significant nucleotide similarity (88%) with L. cuprina AChE. The deduced amino acid sequence of NWS AChE was compared to the AChE amino acid sequences from other fly species, showing a high identity with L. cuprina (93%), Haematobia irritans (90%), M. domestica (90%) and D. melanogaster (88%). The W222 residue (position according to sequence of C. hominivorax), the main component of the choline binding site, is conserved among the species. The predicted members of the catalytic triad correspond to residues in the positions Serine374, Glutamate503 and Histidine616 (S200, E327, H440 in Torpedo californica, Schumacher et al., 1986) ( Fig. 2).

, 1996, Tran et al., 2007 and Yazdani and Terman, 2006). Previous work has shown that Sema5A and Sema5B can act as guidance cues to either attract or repel processes belonging to different neuronal populations (Goldberg et al., 2004, Hilario et al., 2009, Kantor et al., 2004, Lett et al., 2009 and Oster et al., 2003). We generated mice harboring knockout alleles

of Sema5A and Sema5B by targeting exon 6 of Sema5A and exon 2 of Sema5B, each of which encode the first 41 or 51 amino acids, respectively, of these proteins (see Figure S1 available Selleckchem Ivacaftor online). Our Sema5A and Sema5B mutant mice lack full-length Sema5A and Sema5B proteins ( Figures S1G and S1H). Unlike the early embryonic lethality observed in previously generated Sema5A null mice (in a mixed 129/NMRI genetic buy I-BET151 background) ( Fiore et al., 2005), we found that in a 129/C57BL/6 mixed genetic background, our Sema5A−/−, Sema5B−/−, and Sema5A−/−; Sema5B−/− mice are viable and fertile. This difference could be due to either the utilization of different targeting strategies and/or mouse genetic backgrounds. These results strongly suggest that our Sema5A and Sema5B mutant mice are null

mutants. Sema5A−/−; Sema5B−/− mice exhibit severe defects in the stereotypic neurite arborization of multiple amacrine cell types. In Sema5A−/−; Sema5B−/− mice, tyrosine hydroxylase (TH)-expressing dopaminergic amacrine cells, which predominantly stratify within the S1 sublamina of the IPL in wild-type (WT) retinas ( Figure 1I), exhibit dramatic mistargeting within both the INL and OPL ( Figure 1L). Similarly, vGlut3-expressing amacrine cells, which mostly stratify within the S2/S3 sublaminae ADAMTS5 of the IPL in WT retinas ( Figure 1M), show severe neurite mistargeting within both the IPL and INL in Sema5A−/−; Sema5B−/− mice ( Figure 1P). In addition, AII amacrine cells (labeled with Disabled-1 [Dab-1]), cholinergic amacrine cells (labeled with choline acetyltransferase [ChAT]), calretinin-positive cells, and calbindin-positive cells all exhibit

pronounced ectopic neurite extension toward the outer retina in these mutant mice ( Figures 2A–2H). Importantly, these defects are observed with full penetrance and expressivity in Sema5A−/−; Sema5B−/− animals (n = 12 Sema5A−/−; Sema5B−/− mice; n = 12 WT mice). Sema5B−/− mice also exhibit neurite arborization defects involving these same neuronal subtypes ( Figures 1K and 1O; data not shown), although these phenotypes are less severe than those seen in Sema5A−/−; Sema5B−/− mice. Sema5A−/− mice, and also Sema5A+/−; Sema5B+/− mice, did not show defects in these same classes of retinal neurons ( Figures 1J and 1N and Figure S2; data not shown). These results suggest that Sema5A and Sema5B play redundant roles in regulating multiple amacrine cell neurite arborization events in vivo.

, 1999). Given the broad expression patterns of TrkC and PTPσ during development, some loss-of-function defects may be because of loss of critical trans interaction of TrkC and PTPσ outside synapses. Our study raises a number of questions for future research. We show here

that the bidirectional synaptic organizing function of TrkC-PTPσ occurs independently of kinase and phosphatase activity, but whether this interaction triggers or otherwise regulates catalytic activity is unknown. This is the first trans interaction of which we are aware between a tyrosine kinase and a tyrosine phosphatase, and it may represent a mechanism for regulating the balance of tyrosine phosphorylation. It will be important to determine whether binding of PTPσ activates TrkC Romidepsin kinase and/or whether binding of TrkC activates PTPσ phosphatase. It will be particularly interesting to determine how the TrkC-PTPσ adhesion complex regulates glutamatergic synaptic signaling pathways and how NT-3 modulates this process. TrkC kinase activation initiates multiple pathways including Ras-Erk1/2, Src, and PI3K-Akt (Huang and Reichardt, 2003), pathways shown to alter

AMPA and NMDA-mediated transmission (Sheng and Kim, 2002). N-cadherin is a major substrate of PTPσ (Siu et al., 2007), raising the potential for TrkC-PTPσ modulation VX-809 datasheet of other synaptic adhesion complexes. The distinct binding sites could allow for simultaneous binding of PTPσ and NT-3 to TrkC, via LRR-Ig1 and Ig2, respectively. NT-3 may modulate the synaptogenic activity of TrkC, for example, by inducing TrkC dimerization and internalization. PTPσ also binds via its first Ig domain to chondroitin and heparan sulfate proteoglycans to inhibit axon regeneration (Aricescu et al., 2002 and Shen et al., 2009). Whether TrkC and proteoglycans compete for binding to PTPσ and consequences for axon regeneration and synaptogenic activity remain to be determined. The TrkC-PTPσ interaction may function in diverse processes including cell proliferation

and differentiation, axon guidance and regeneration, and excitatory synaptic assembly and signaling. Cultures of hippocampal neurons, neuron-fibroblast cocultures, and immunocytochemistry were performed essentially as described (Linhoff et al., 2009). Transfections into very COS-7 cells and hippocampal neurons were done by using FuGENE 6 (Roche) and the ProFection Mammalian Transfection System (Promega), respectively. The cDNAs for full-length rat TrkCTK- (BC078844), TrkCTK+ (NM_019248), TrkCKI25 (AAB26724.1), TrkA (NM_021589), TrkBTK- (NM_001163168), TrkBTK+ (NM_012731), and p75NTR (NM_012610) were cloned by RT-PCR from a P11 rat brain cDNA library (Linhoff et al., 2009) and subcloned into pcDNA3 vectors. Deletion and swap mutants of TrkC were made based on domain structures described by Barbacid (1994). Additional details are provided in Supplemental Experimental Procedures.

Acute knockdown of GABARAP by siRNA in cultured neurons has revealed a role of GABARAP in rapid NMDA-induced functional plasticity of inhibitory synapses (Marsden et al., 2007). NMDA receptor-mediated Ca2+ influx following moderate stimulation of neurons with NMDA leads to a rapid increase in the number of postsynaptic GABAAR clusters and mIPSC amplitudes (see also further below and Figure 5C). In addition to GABARAP this mechanism involves Ca2+ calmodulin-dependent kinase II (CaMKII), the vesicular trafficking factor N-ethylmaleimide-sensitive PI3K Inhibitor Library factor (NSF), and glutamate receptor interacting protein (GRIP).

The rate of GABAAR endocytosis following treatment with NMDA was unaltered, suggesting that GABARAP-dependent potentiation of inhibitory synapses involves increased exocytosis rather than reduced endocytosis of GABAARs (Marsden et al., 2007). These findings represent thus far the only loss-of-function experiments showing an essential role for endogenous GABARAP in GABAAR trafficking. The relevant protein-protein interactions and CaMKII phosphorylation targets have so far not been identified. However, experiments in

heterologous cells allow speculation that this mechanism might involve CaMKII-induced phosphorylation of the β3 subunit at S383 (Houston et al., 2007). The data selleckchem summarized thus far suggest that GABARAP promotes the regulated, activity-dependent, and CaMKII-mediated translocation of GABAARs from intracellular compartments to

the somatodendritic plasma membrane. However, a more general role of GABARAP in exocytosis of GABAARs is difficult Astemizole to reconcile with other findings. First, GABARAP has been proposed to contribute to rebound potentiation, a neural activity-induced postsynaptic form of long-term potentiation (LTP) of inhibitory synapses on Purkinje cell neurons (Kawaguchi and Hirano, 2007). Using electrical stimulation of cultured Purkinje cells to mimic rebound potentiation, the authors found evidence that this form of plasticity is critically dependent on a CaMKII-dependent conformational alteration of GABARAP. However, LTP of GABAergic synapses occurred without measurable changes in the cellular distribution and cell surface expression of GABAARs. Given that GABARAP is absent at synapses (Kneussel et al., 2000 and Kittler et al., 2001), the exact role of GABARAP in this form of plasticity requires further clarification. Second, the aforementioned PE conjugation of GABARAP is critically involved in autophagy, an evolutionarily conserved form of bulk transport of membranes and cytoplasm to lysosomes for protein degradation (Tanida et al., 2004). Consistent with a role of GABARAP in autophagy, there is evidence that GABAARs are subject to autophagy in worms. Body wall muscle cells of C.

Initial studies in Drosophila advanced the knowledge on CSP-α function ( Zinsmaier et al.,

1994). Later, knock-out mice lacking CSP-α opened new possibilities trans-isomer solubility dmso to study different synapses with high resolution physiological methods ( Fernández-Chacón et al., 2004). We know that 1), CSP-α is not an essential molecular component to execute neurotransmitter release early postnatally in fast synapses like the calyx of Held, but it is required to maintain synaptic function after 3 weeks of age ( Fernández-Chacón et al., 2004); 2), CSP-α cooperates with α-synuclein to maintain the stability of the SNARE-complex that fails to assemble efficiently when CSP-α is absent ( Chandra et al., 2005, Sharma et al., 2011a and Sharma et al., 2011b); and 3), CSP-α is likely most required at the synaptic terminals with high activity ( Fernández-Chacón et al., 2004, García-Junco-Clemente et al., 2010 and Schmitz et al., 2006). Those observations indicate that CSP-α acts as a chaperone to rescue proteins that might become unfolded by the effect of

maintained synaptic activity ( Sharma et al., 2011b). SNAP-25 is the most remarkably reduced synaptic protein in CSP-α knockout mice ( Chandra et al., 2005, Sharma et al., 2011a and Sharma et al., 2011b). Perhaps, other synaptic proteins become functionally altered. A systematic functional study of the complete synaptic vesicle cycle in CSP-α KO mice would be useful to investigate further molecular alterations. Now, using quantal analysis at the neuromuscular MK0683 chemical structure junction (NMJ) we describe a significant decrease in the number of vesicles available for release, likely explained

by a priming defect as a consequence of reduced SNAP-25 levels. In addition, using synaptopHluorin (spH) imaging of the synaptic vesicle cycle at the NMJ, we have found specific alterations in synaptic vesicle recycling that might contribute to nerve terminal progressive degeneration when CSP-α is absent. Specifically, we demonstrate that motorneurons require CSP-α for the maintenance of synaptic release sites and synaptic vesicle recycling. CSP-α KO mice expressing spH developed the strong neurological phenotype that causes mafosfamide early lethality within 1–2 months of age as previously described (Fernández-Chacón et al., 2004). We used the levator auris longus (LAL) nerve–muscle preparation ( Angaut-Petit et al., 1987) to study synaptic transmission with electrophysiology ( Rozas et al., 2011) and with spH imaging ( Tabares et al., 2007). We first studied spontaneous release and detected fibers with “bursts” of miniature end-plate potentials (MEPP), as previously described in CSP-α KO mice ( Ruiz et al., 2008). However, when we excluded those fibers from our analysis, MEPP amplitude was similar in control and mutant synapses (1.03 ± 0.08 mV for wild-type (WT) and 1.

After 250 ms, however, the majority of cells (n = 40, 85%) accurately reflected the response values predicted by the steady-state gain fields (Figure 4C, two-saccade cells). The remainder of the cells (n = 7, 15%) did so by 350 ms (Figure 4D,

two-saccade cells). The median values of the gain field indices had a similar time course (Figure 4E). We also calculated the time point of transition from nonveridical to veridical eye position information (see Experimental find more Procedures; Figure 4F). 43 of the 47 cells (91%) reported the steady-state values in the same stimulus interval for saccades in both directions. We recorded 13 cells that had no eye-position modulation of visual responses to test if the spatial inaccuracy BAY 73-4506 of immediate postsaccadic visual responses were simply the result of flashing stimuli around the time of a saccade. For these cells, responses to visual probes were not statistically different (p > 0.05 by KS test) regardless of the probe delay and the direction of the first saccade (Figure S2). Although the gain fields among the population of neurons reflect eye position inaccurately immediately after the first saccade in the two-saccade task, there is a potential shortcoming to using

this task to assess the monkey’s behavioral performance during this period. In the two-saccade task, the retinal location of the second target and the vector of the saccade necessary to acquire it are coincident. Therefore, it could be argued that the task does not depend on the accuracy

of the gain fields since it can be solved without employing a supraretinal many mechanism. The double-step task has been used to show that the oculomotor system can compensate for an intervening saccade and accurately acquire a target even when there is a dissonance between the retinal location of a target and the vector of the saccade necessary to acquire it (Hallett and Lightstone, 1976). If the brain used a gain-field mechanism to solve the double-step task, the position of targets flashed immediately after a saccade would be calculated as if the eyes had not moved. We used the three-saccade task (Figure 5A), which cannot be solved without employing a supraretinal mechanism, to test if the inaccuracy of the gain fields immediately after a conditioning saccade was reflected in the monkeys’ behavior. In this task, the monkey performed a traditional double-step task following a conditioning saccade in the high-to-low or low-to-high gain field direction. Two targets, one blue and one red (the probe), appeared simultaneously 50, 550, or 1,050 ms after the end of the first saccade. The red probe flashed in the cell’s receptive field for 75 ms and disappeared.

Thus, Cre activity in Krox20+/Cre mice is present in a neuron population that includes calyx of Held-generating neurons in the cochlear nucleus, which explains the presence of tdRFP-positive large nerve endings in the MNTB. We crossed the Krox20Cre/+ mice with floxed RIM1/2 mice (Kaeser et al., 2011) to generate conditional RIM1/2 double KO mice specific for the auditory brainstem. Because of germline recombination in the Krox20Cre line (Voiculescu et al., 2000), we obtained Cre-positive RIM1/2 lox/Δ

mice (see Experimental Procedures). These mice were viable and fertile, which allowed us ZD1839 mouse to investigate synaptic transmission in brain slice preparations. We will refer to synapses recorded in Cre-positive RIM1/2 lox/Δ mice as RIM1/2 cDKO synapses (for conditional double KO). As a control group, we used Cre-negative, BKM120 datasheet RIM1/2 lox/Δ littermate mice (see Experimental Procedures). Excitatory postsynaptic currents (EPSCs) evoked by afferent fiber stimulation at calyx of Held synapses in RIM1/2 cDKO mice had amplitudes of only 1.86 ± 1.73

nA (n = 12 cells), significantly smaller than in Cre-negative littermate control mice (9.8 ± 4.2 nA; n = 15 cells; Figures 1C and 1D). The evoked EPSCs also had slightly, but significantly slower rise times (Figures 1E and 1F; p = 0.0038), reflecting slowed release kinetics that will be analyzed in more detail below (see Figure 4 and Figure 5). The amplitude of spontaneous, miniature EPSCs (mEPSCs) was unchanged (Figure 1G), consistent with a presynaptic transmitter release deficit. Synaptic phenotypes were consistently observed in all synapses studied in RIM1/2 cDKO mice tuclazepam (n = 73). This indicates that Cre-mediated removal of the RIM proteins was effective, without detectable inhomogeneity across the population of the studied neurons. Having established the conditional removal of all long RIM isoforms at the calyx of Held, we are now in a position to directly study the presynaptic

function of RIM1/2 proteins. In current clamp recordings from calyces of Held, presynaptic APs elicited by afferent fiber stimulation were unchanged in RIM1/2 cDKO calyces (Figure 2), showing that changes in the AP waveform do not underlie the reduced transmitter release. We next investigated presynaptic Ca2+ currents in voltage-clamp recordings of the calyx of Held. Surprisingly, these recordings revealed a strong reduction of the amplitude of Ca2+ currents in RIM1/2 cDKO calyces (Figure 2C). In both genotypes, presynaptic Ca2+ currents started to activate at around −20 mV and the maximal Ca2+ current was observed at ∼0 mV (Figures 2C and 2D); however, the maximal Ca2+ current was only 500 ± 310 pA (n = 19 cells) in RIM1/2 cDKO calyces, whereas it was 1040 ± 250 pA (n = 9) in calyces of control mice (Figure 2E; p < 0.001).

The two men who employed RFS were among the largest (54.6 and 58.2 kg), and their mean running speed (3.55 m/s) was near the mean of the men’s sample. Notably, there was no difference in hip height between men and women in the Hadza sample (p = 0.44, t test) indicating that sex differences in foot strike usage were not a result of differences in hind limb length. Whatever the reason for their foot strike preference, it is notable that MFS is common among Hadza men even though they rarely run. This finding

holds implications for the evolution of human running gait. In populations with even minimal experience running, we can expect that many individuals would prefer MFS (or perhaps FFS) rather than RFS on occasions when they do run. Some threshold level

of exposure to running may be necessary to promote MFS or FFS, but extensive TSA HDAC solubility dmso running experience is not needed. Thus check details MFS (and perhaps FFS) may have been common among hunter-gatherer groups in the past, even those that did not engage in endurance running or employ exhaustion hunting techniques regularly. Including our data from this study, foot strike behavior during running has been described for only three habitually barefoot or minimally shod populations. The variability in foot strike preference both within and between these groups is notable, and suggests caution is warranted when drawing conclusions about “average” or “typical” gait in unshod populations. Rolziracetam For example, it is possible that groups such as the Daasanach run with RFS due simply to a lack of endurance running experience. Documenting

foot strike behavior and other aspects of walking and running gait in other barefoot and minimally shod populations will improve our understanding of cultural and ecological factors influencing locomotor behavior and anatomy in humans. We thank Fides Kirei for assistance with data collection, and Lauren Christopher, Annie Qiu, and Khalifa Stafford for assistance with video analysis. Daniel Lieberman and two anonymous reviewers provided comments that improved this manuscript. Funding was provided by the National Science Foundation (BCS-0850815) and Hunter College. “
“In modern times, runners usually land on their heels using cushioned running shoes to absorb the impact.1, 2 and 3 The differences in foot position during landing are used to classify various running styles; “toe-heel-toe” running or forefoot strike (FFS), “flat-footed” running with a midfoot strike (MFS), or “heel-toe” running with a rearfoot strike (RFS).4, 5 and 6 The majority of habitual barefoot runners FFS or MFS, while the majority of habitual shod runners RFS.5, 6, 7, 8 and 9 Due to the lower occurrence of both FFS and MFS runners (5%–25%), they are often grouped together as an FFS running style, where the point of impact of the foot occurs anterior to the ankle joint.

, 1997; Izumi and Zorumski, 2009). In brain slices treated with 4-CIN (100 μM), application of 10 mM [K+]ext significantly increased extracellular lactate (81.0 ± 6.4 μM, n = 5; + 4-CIN: 121.7 ± 7.0 μM, n = 7 p < 0.001; Figure 5A), suggesting that when neuronal lactate uptake is inhibited by 4-CIN, more lactate is free to diffuse out of the brain slice into the superfusate. Previous studies have demonstrated that when extracellular glucose levels are reduced, lactate www.selleckchem.com/GSK-3.html is produced by astrocytes and provided to neurons to promote neuronal viability (Aubert et al., 2005; Izumi et al., 1997; Wender et al., 2000). Furthermore, aglycemia is associated with alkalinization (Bengtsson et al., 1990; Brown et al., 2001), which could subsequently

activate sAC. Therefore, we tested the hypothesis Panobinostat cost that aglycemia recruits sAC to initiate the astrocyte-neuron lactate shuttle. We first examined whether aglycemic condition induced astrocyte alkalinization. We used two-photon laser scanning microscopy to image the pH-sensitive dye BCECF/AM to monitor astrocytic intracellular pH change in aglycemic condition. We found that applying aglycemic solution induced a gradual alkalinization of intracellular pH in astrocytes (Figure S7). Next, we examined the

effect of aglycemia in brain slices on the production of cAMP. We detected increased cAMP in slices when exposed to aglycemic aCSF (control; 10 mM glucose: 4.4 ± 0.4 pmol/ml, n = 6; 0 glucose: 6.2 ± 0.3 pmol/ml, n = 7, p < 0.01; Figure 5B) and this increase was significantly inhibited by 2-OH (5.3 ± 0.1 pmol/ml, n = 7, p < 0.05; Figure 5B) and DIDS (4.3% ± 0.3%, n = 7, p < 0.01; Figure 5B), indicating bicarbonate-sensitive sAC is activated by glucose-free condition. We further tested the hypothesis that sAC was responsible for coupling aglycemia to glycogen breakdown in astrocytes

and for the production and release of lactate. Depleting extracellular glucose for 30 min significantly reduced glycogen levels in brain slices (control: 100%, n = 11; 0 glucose: 43.0% ± 6.6%, n = 12, p < 0.01; Figure 5C). This effect was prevented by sAC inhibition with KH7 (85.5% ± 9.4%, n = 7, p < 0.01; Figure 5C) and NBC antagonist DIDS (93.1% ± 11.8%, n = 7, p < 0.01; Figure 5C). Treating with 4-CIN 4-Aminobutyrate aminotransferase in the absence of glucose significantly increased extracellular lactate (98.5 ± 3.6 μM, n = 4) compared to glucose deprivation alone (56.5 ± 5.7 μM, n = 4, p < 0.001; Figure 5D), an effect that was partially inhibited by 2-OH (79.0 ± 2.6 μM, n = 6, p < 0.001; Figure 5D) or oxamate (76.3 ± 2.9 μM, n = 3, p < 0.001; Figure 5D), suggesting sAC and LDH involvement, respectively. To further explore whether this sAC-dependent lactate shuttle has functional consequences to the maintenance of neuronal activity when the supply of glucose is compromised, we recorded field excitatory postsynaptic potentials (fEPSPs) in the stratum radiatum of the CA1 region during aglycemia in the presence or absence of 2-OH.